ancestor_project

Design of the Ancestry project. Part I

An important advancement in possessing the sequence of the human genome is the amount of valuable information we can extract from it. We now have enough knowledge to know that a single DNA base at a specific location might affect the probability of developing a disease or might help pinning down the geographical origin of our ancestors. Our current project is essentially interested in the second part.

The variability observed at these specific DNA bases (called SNPs for Single Nucleotides Polymorphisms) is in some cases specific to human populations. For example, a gene X has two different alleles, which corresponds to two versions of the gene X:

Allele A: …CCTGCGATCGATGCTAGCTAG…..TGATCTGATCGTAATGCTGA…

Allele B: …CCTGCGATCGATGCTACCTAG…..TGATCTGATCGTAATGCTGA…

 

For a region of the gene X, we see that one base of the DNA (a SNP) differs between the allele A and B. In fact, several hundred SNPs have been liked to specific human populations and can therefore be used to determine the ancestry of a person. For example, the allele A might be found only in European and Asian people whereas the allele B is found only in American and African people.

In our case, we are using PCR to determine for specific SNPs which DNA base we have. The idea of the PCR is to exclusively amplify a sequence of DNA to obtain a really high number of molecules which can then be seen on a gel. To amplify specifically a sequence of DNA, we use DNA primers which are short sequence of DNA specific to a specific position in the genome.

Since every human has two sets of chromosomes and therefore two exemplary of each gene, a person will be either AA, BB, or AB corresponding to two parents European/Asian, American/African, or one parent European/Asian and the other one American/African.

To test this, we need to design three primers which corresponds to the sequences underlined. It was shown that the last nucleotide of the primer must be complementary to genomic DNA for the PCR to be productive.

Primer 1a: 5’-CTGCGATCGATGCTAG-3’

Primer 1b: 5’-gtattatctttgataataatcCTGCGATCGATGCTAC-3’

Primer 2: 5’-CAGCATTACGATCAG-3’

 

The primer 2 is the same for both reactions since there is no mutation in this region. The primer 1a is specific to the allele A whereas the primer 1b recognize only the allele B but we add for this primer a tail on the 5’ end (in lowercase). The presence of the tail will not modify the efficiency of the PCR but will produce a larger final product which can then be differentiate from the product of the allele A on the gel. This larger product is also necessary to determine if someone is heterozygote (AB) rather than homozygote (AA or BB).

SNPs_PCR Example

Our idea is then to multiplex this method by checking in a single reaction four SNPs. If the SNPs are close to each other, we can design four primers (1a, 1b, 2a, and 2b) with a different tail’s size for three of them to facilitate the reading of the gel. If the SNPs are too far away, the approach will be similar to the one explained above.

Amplification of human genomic DNA

Last time we extracted our own genomic DNA. To determine whether the extracted DNA is of good quality, we tried to amplify a fragment of the human PDE1C gene by Polymerase Chain Reaction (PCR).

The two primers used were:

PDE1C_for: 5′-CTGGAACCAGTGCCACTATAA-3′; melting temperature of 54oC.

PDE1C_rev: 5′-CGACTTCAGCCATCTCTCTATC-3′; melting temperature of 55oC.

The conditions used for the PCR are accessible here.

We were expecting a 314 bp long fragment and the PCR products were run on an 1% agarose gel.

PCRgDNA_191114b

As expected, there was no band observed in the Negative Control since the kiwi does not contain the PDE1C gene which is always a good news. For our own genomic DNA, only the PC and M lanes produce the expected band. For the Y lane, we observed two bands at 100 bp which should correspond to some amplified DNA since the primers are only 21 bp long.

Since not all the extracted DNA worked as expected, we will try a new DNA extraction protocol.

Fingerers crossed we’ll get a hold of cheap method for extracting genomic DNA using kitchenware materials without the reliance on professional kits! This hopefully will give us the ability to test our own DNA for interesting genetic variants!

Extraction of our (human) genomic DNA

After a preliminary successful extraction of DNA from kiwi with a standard protocol (here or here), we decided to try if we could do the same with our own DNA. The general principle is similar to extracting DNA from fruits except that we start with far less material.

Water_salt

The first step was to obtain some cells from our body! The easiest and quickest way is to retrieve cells present in our mouth. For this, we first prepare a mixture of water and salt (2 spoons of salt in 100 ml of tap water) and gargle it for 30-45 seconds.

The liquid now contains human cells and other stuff such as bacteria. The next step is to break the cells to release our genomic DNA in the solution. To do this, we just added a spoon of kitchen detergent to the solution and mix it.

AfterGargleDetergentAfterDetergent

SoySauce

To improve the visualisation of DNA, we also add some soy sauce to the solution to make it darker. However, since we retrieve at the end more DNA than expected, this step can be removed since it doesn’t help the final purification steps.

The penultimate step is to precipitate DNA by adding pure isopropanol to the solution and mix it. It generally takes a few minutes before the DNA start to became visible. We transferred some of our DNA to a clean tube with pipettes to keep it frozen until we test it by PCR with primers again a specific human gene to verify that we really have genomic human DNA (more about this next time).

IsoproHPIM2921HPIM2916

                                                           DNA is visible in the tip             DNA pellet with soy sauce

Just to compare to the amount of DNA retrieved from the kiwi extraction (all the white stuff in the bottle) and a photo of the material used for extraction:

                         HPIM2907     HPIM2926